Pgex 2t sequence. This plasmid is available through Addgene.

Pgex 2t sequence. BLAST returns plasmids with similarity to the query sequence. FASTA headers and numbers at the beginning of Expression: Bacterial Use:pGEX Plasmid pGEX-2T Description pGEX-2T is an E. coli, ideal for research and biotechnology applications. Results are sorted by E-value, a statistic from BLAST that describes the significance of a match. The protein kinase site is located between the thrombin recognition site and the MCS Displays a graphical map based on nucleotide sequence data labeled with restriction enzymes, plasmid features, ORFs (theoretical open reading frames) and primers. 274 (7):4266-72. The lacIq gene product is a repressor protein The pGEX vectors have an expanded multiple cloning site (MCS) that contains six restriction sites. pGEX-6P-1, pGEX-6P-2, and pGEX-6P-3 each encode the recognition sequence for site-specific cleavage by PreScission Protease between the GST domain and Search by Sequence performs a nucleotide-nucleotide or protein-translated nucleotide BLAST search against Addgene’s plasmid sequence database. Download SnapGene Download SnapGene Viewer Explore Over 2. coli. pGEX-1lambdaT, pGEX-4T-1, pGEX Plasmid pGEX-2T-M from Dr. The pGEX vectors have an expanded multiple cloning site (MCS) that contains six restriction sites. 1999 Jan 1. The synthetic oligonucleotide shown in Fig. Expressed proteins can be directly labeled using protein kinase and [gamma-32P]ATP and readily detected using standard radiometric or autoradiographic techniques. Plasmid pGEX-2T FRB S2035I from Dr. japonicum GST from pGEX vectors has been determined and matches that of the native protein. Ben Neel's lab contains the insert SHP1 and is published in Proc Natl Acad Sci U S A 1992 Feb 1;89 (3):1123-7. This vector is NOT available from Addgene and the database is no longer actively maintained. 2017 Oct 13;45 (18):10726-10739. thrombin or factor Xa protease sites to cleave protein from fusion. Nine of the vectors have an expanded multiple cloning site (MCS) that contains six restriction sites. Related vectors: p4. FASTA headers and numbers at the beginning of Plasmid pGEX-2T SHP1 WT from Dr. The user-defined upper limit for the number of target sequences returned region of similarity between target and query sequences a BLAST statistic representing the significance of an alignment, values close to zero indicate high sequence similarity with low probability of the similarity occurring by chance the number of exact nucleotide matches over the alignment, expressed as a fraction and a user-defined upper limit for the number of target sequences returned region of similarity between target and query sequences a BLAST statistic representing the significance of an alignment, values close to zero indicate high sequence similarity with low probability of the similarity occurring by chance the number of exact nucleotide matches over the alignment, expressed as a fraction and a Bacterial vector for expressing GST fusion proteins with a PreScission protease site. FASTA headers and numbers at the beginning of Bacterial vector for expressing GST fusions with a thrombin site and a cAMP kinase site. Please go to Addgene’s search for empty backbones to search Addgene plasmids. The crystal structure of recombinant S. coli protein expression vector, and the Tac promoter drives the fusion expression of GST tagged protein and target protein. The protein kinase site is located between the thrombin recognition site and the MCS Plasmid pGEX-2T-NM from Dr. FASTA headers and numbers at the beginning of Plasmid pGEX-2T FRB from Dr. Expression is under the control of the tac promoter, which is induced by the lactose analog isopropyl ơ‐D‐thiogalactoside (IPTG). - Visit Zettalab (Plasmid) plasmid library, which brings together massive resources covering tens of thousands of top-tier biological journal articles. 1999 Feb 12. The circular cloning vector generates high level intracellular expression of whole genes or gene fragments from The protein kinase site is located between the GST domain and the MCS. FASTA headers and numbers at the beginning of Search by Sequence performs a nucleotide-nucleotide or protein-translated nucleotide BLAST search against Addgene’s plasmid sequence database. FASTA headers and numbers at the beginning of each line will be removed. pGEX-2TK has a different MCS from that of the other vectors. pGEX-series GST fusion vector with Ptac promoter, lacI repressor, thrombin cleavage and kinase site ORFS; amp resistance; restriction enzyme cloning. Download scientific diagram | Vector Map of pGEX-2T from publication: Molecular Cloning and Overexpression of WAP Domain of Anosmin-1 (a-WAP) in Escherichia coli | Molecular Cloning and Search by Sequence performs a nucleotide-nucleotide or protein-translated nucleotide BLAST search against Addgene’s plasmid sequence database. [2] Bacterial vector for expressing GST fusion proteins with a thrombin site. File contains the nucleotide sequence and annotated features in GenBank flat file format. We narrowed to 1,697 results for: pGEX Showing: 1 - 20 of 1697 results Results per page: Previous 1 2 3 4 Next Full Sequences from Addgene (1) Based on next-generation sequencing (NGS) results where indicated (Addgene NGS Result), or assembled from reference sequences and/or Sanger results (Addgene Assembled Sequence). All pGEX vectors are also engineered with an internal lacIq gene. The tool works with standard single letter nucleotide or protein codes including ambiguities and can match Prosite patterns in protein sequences. Susan Lindquist's lab contains the insert NM and is published in Nat Struct Biol 2001 Nov;8 (11):958-62. Vesa Hytönen's lab contains the insert PV1 VP1 protein with Histag and is published in Microbiol Spectr. user-defined upper limit for the number of target sequences returned region of similarity between target and query sequences a BLAST statistic representing the significance of an alignment, values close to zero indicate high sequence similarity with low probability of the similarity occurring by chance the number of exact nucleotide matches over the alignment, expressed as a fraction and a Displays a graphical map based on nucleotide sequence data labeled with restriction enzymes, plasmid features, ORFs (theoretical open reading frames) and primers. FASTA headers and numbers at the beginning of Exact conditions must be established for each protein. Information Source/Vendor GE Healthcare Life Sciences Plasmid Type Bacterial Expression Cloning Method Unknown Size 4969 Tag 1 GST fusions Tag 2 thrombin site Tag 3 cAMP kinase site Notes pGEX-2TK can label expressed protein in vitro by site for cAMP- dependent protein kinase from heart muscle. Search by Sequence performs a nucleotide-nucleotide BLAST search against Addgene’s plasmid sequence database. For other reading frames, use pGEX-6P-1 or pGEX-6P-3. Jie Chen's lab contains the insert mTOR and is published in J Biol Chem. Note: Usually use pGEX-PP-GFP for SLIC cloning and negative selection (WISP10-32) Plasmid pGEX-2T-GST-eIF4E K119A from Dr. We provide comprehensive and professional biological experimental methods and research tool guides, covering extensive experimental techniques, leading researchers with pGEX-2TK has a different MCS from that of the other vectors. 1128/spectrum. Discrepancies between sequencing results obtained by Addgene and the original sequence provided by the depositor may be present. The following primers for double-stranded sequencing of pGEX vectors are available: 5’ pGEX Sequencing Primer (bases 869–891) and 3’ pGEX Sequencing Primer (bases 1020-998). Provide pGEX-2T vector/plasmid map, full length sequence, antibiotic resistance, size and other information Information Source/Vendor GE Healthcare Life Sciences Plasmid Type Bacterial Expression Expression Level Unknown Cloning Method Unknown Size 4948 Tag 1 GST fusion proteins with a thrombin site Notes thrombin or factor Xa protease sites to cleave protein from fusion. Open the file with a text editor or plasmid mapping software to view the sequence. The protein kinase site is located between the thrombin recognition site and the MCS Provide pGEX-6P-2 vector/plasmid map, full length sequence, antibiotic resistance, size and other information Search by Sequence performs a nucleotide-nucleotide or protein-translated nucleotide BLAST search against Addgene’s plasmid sequence database. The pGEX ベクターマップ pGEX-2T (28-9546-53) Thrombin Leu Val Pro Arg Gly Ser Pro Gly Ile His Arg Asp CTG GTT CCG CGT GGA TCC CCG GGA ATT CAT CGT GAC TGA CTG ACG BamH I Sma I EcoR I Stop codons Thirteen pGEX vectors are available (see Figure). The protein kinase site is located between the thrombin recognition site and the MCS Thirteen pGEX vectors are available (see Figure). Hosts: E. The PGEX-2T is a plasmid vector used for the expression of recombinant proteins in Escherichia coli. The sequence is broken up into codons and the encoded amino acid for each is given in its single-letter code 5. These vectors are not available from Addgene and the database is no longer actively maintained. > pGEX-2T-TRR-C421-Y2404F sequence 1263 bps ATGGGTGCAGGAGCAGGCGCCACGACTGGCGCCGGATTAGGAGGCTCTGTGGCAGATAATGAACTGAGCT CCCTGGTTGTCCACCGGAGAGTTTTTGTCGATCGGGATGAAAACCGTCAGGTGGCCACCGTCATGCACTA TTCAGAGCTAAGCAACCTGCTCCGTGTGGGCAACATGACGTTCCTGAACGTGGGTCAGTTACTGCCGCAT CAGCTGGAGGCCTTCCACACACCCCACTACATCTACCCCATTGGCTACAAGGTGAGTCGCTACTACTGGT Displays a graphical map based on nucleotide sequence data labeled with restriction enzymes, plasmid features, ORFs (theoretical open reading frames) and primers. Copy each of the sequences Bacterial vector for expressing fusion proteins with a thrombin site. Learn about AAV and antibody materials from user-contributed reports Analyze a DNA sequence to see restriction sites and map Browse a digital-only collection of vector backbone information Access unparalleled plasmid and sequence data to accelerate your research and fuel groundbreaking discoveries in life sciences and beyond. Many native proteins contain an N-terminal methionine and this residue at position P1' would fit into the consensus cleavage sequence. pGEX-1lambdaT, pGEX-4T-1, pGEX-5X-1 accept cDNA from lambda gt11 libs. 5, pS, pGEX-1, pGEX-3X The following primers for double-stranded sequencing of pGEX vectors are available: 5’ pGEX Sequencing Primer (bases 869891) and 3’ pGEX Sequencing Primer (bases 1020998). Search by Sequence performs a nucleotide-nucleotide or protein-translated nucleotide BLAST search against Addgene’s plasmid sequence database. pGEX-2TK is a derivative of pGEX-2T; its fusion proteins can be cleaved with Thrombin. Appendix 1 shows the characteristics of GST, as determined in pGEX-1N Learn about AAV and antibody materials from user-contributed reports Analyze a DNA sequence to see restriction sites and map Browse a digital-only collection of vector backbone information Access unparalleled plasmid and sequence data to accelerate your research and fuel groundbreaking discoveries in life sciences and beyond. doi: 10. Displays a graphical map based on nucleotide sequence data labeled with restriction enzymes, plasmid features, ORFs (theoretical open reading frames) and primers. pGEX-6P-1, pGEX-6P-2, and pGEX-6P-3 each encode the recognition sequence for site-specific cleavage by PreScission Protease between the GST domain and To select a portion of sequence, click one location on the plasmid and then a second location to display the sequence between the two locations. pGEX vectors, GST Gene Fusion System Map of the glutathione S-transferase fusion vectors showing reading frames and main features. Even though stop codons in all three frames are not depicted in this map, all thirteen vectors have stop codons in all three frames downstream from the multiple cloning site. Welcome to Vector Database! Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources. For other reading frames, use pGEX-4T-2 or pGEX-4T-3. Epub 2023 May 25. May 1, 1992 · The thrombin cleavage sites found in pGEX-2T, pGEX-KG, and pGEX-KT (LVPRSG) conform to this consensus sequence. Displays both strands of base paired nucleotide sequences with annotated enzymes, plasmid features, ORFs (theoretical open reading frames) and primers. pGEX-2T Bacterial vector for expressing GST fusion proteins with a thrombin site. 1093/nar/gkx801. This plasmid is available through Addgene. This vector contains the recognition sequence for the catalytic subunit of cAMP-dependent protein kinase obtained from heart muscle. coli Expression Vector Promoter: Tac Size: 4898 bp 5' Sequencing primers and sequences: pGEX5': GGGCTGGCAAGCCACGTTTGGTG 3' Sequencing primers and sequences: pGEX3': CCGGGAGCTGCATGTGTCAGAGG Tags: N-GST Resistance (s): Ampicillin (Amp) user-defined upper limit for the number of target sequences returned region of similarity between target and query sequences a BLAST statistic representing the significance of an alignment, values close to zero indicate high sequence similarity with low probability of the similarity occurring by chance the number of exact nucleotide matches over the alignment, expressed as a fraction and a pGEX Vectors*(GST Gene fusion) All of the GST gene fusion vectors offer: Information Source/Vendor Amersham Alt Name pGEX-4T-1 Plasmid Type Bacterial Expression Promoter tac Cloning Method Unknown Size 4969 5' Sequencing 1 Primer pGEX5' 5' Sequencing 1 Primer Sequence GGGCTGGCAAGCCACGTTTGGTG Tag 1 GST (Nterm) Tag 2 thrombin site Bacterial Resistance Ampicillin Notes thrombin or factor Xa protease sites to cleave protein from fusion. user-defined upper limit for the number of target sequences returned region of similarity between target and query sequences a BLAST statistic representing the significance of an alignment, values close to zero indicate high sequence similarity with low probability of the similarity occurring by chance the number of exact nucleotide matches over the alignment, expressed as a fraction and a Search by Sequence performs a nucleotide-nucleotide BLAST search against Addgene’s plasmid sequence database. Further information relating to DNA sequence, restriction maps and control regions can be found at: cytiva. Download scientific diagram | Vector Map of pGEX-2T from publication: Molecular Cloning and Overexpression of WAP Domain of Anosmin-1 (a-WAP) in Escherichia coli | Molecular Cloning and pGEX Vectors*(GST Gene fusion) All of the GST gene fusion vectors offer: Search by Sequence performs a nucleotide-nucleotide or protein-translated nucleotide BLAST search against Addgene’s plasmid sequence database. pGEX-6P-1, pGEX-6P-2, and pGEX-6P-3 each encode the recognition sequence for site-specific cleavage user-defined upper limit for the number of target sequences returned region of similarity between target and query sequences a BLAST statistic representing the significance of an alignment, values close to zero indicate high sequence similarity with low probability of the similarity occurring by chance the number of exact nucleotide matches over the alignment, expressed as a fraction and a Constructed from pGEX-2T by inserting an oligonucleotide at the EcoRI site which encodes the glycine kinker and additional restriction sites to facilitate cloning in all reading frames. FASTA headers and numbers at the beginning of Thrombin is a protease used to digest fusion proteins prepared from pGEX vectors (see pGEX Vectors (GST Gene Fusion System)) containing the recognition sequence for thrombin (pGEX-1lT, pGEX-2T, pGEX-2TK, pGEX-4T-1, pGEX-4T-2, and pGEX-4T-3). Addgene plasmids are not included in this database. Additionally, align a custom nucleotide sequence against a given sequence using BLAST2. It is designed to facilitate the production and purification of target proteins. Daniel Schoenberg's lab contains the insert Eif4e and is published in Nucleic Acids Res. 05352-22. Copy sequence Analyze Sequence GenBank SnapGene File Help > pGEX-2T-CBP (1603-2678) sequence 3228 bps > pGEX-2T-CBP (1-287) sequence 858 bps ATGATGGCCGATCACTTAGACGAACCGCCCCAAAAGCGGGTTAAAATGGATCCAACGGATATCTCTTACT TTCTGGAGGAGAACCTGCCCGATGAGCTGGTGTCCTCGAATAGTGGCTGGTCGGATCAGCTGACCGGCGG AGCAGGCGGTGGCAATGGAGGTGGCGGCGCCTCCGGTGTAACCACAAATCCCACATCCGGCCCAAATCCC GGTGGCGGACCCAACAAGCCGGCAGCCCAAGGACCCGGCTCTGGCACAGGCGGAGTCGGTGTTGGAGTGA Plasmid pGEX-2T_PV1_VP1 from Dr. com Download scientific diagram | A schematic diagram of pGEX-2T vector [17, 18]. pGEX-6P-1, pGEX-6P-2, and pGEX-6P-3 each encode the recognition sequence for site-specific cleavage Full Sequences from Addgene (1) Based on next-generation sequencing (NGS) results where indicated (Addgene NGS Result), or assembled from reference sequences and/or Sanger results (Addgene Assembled Sequence). The vector contains a tac promoter, which allows for inducible expression of the gene of interest, and a glutathione S-transferase (GST) tag for affinity-based purification. Plasmid pGEX-2T PTP-1B from Dr. The following primers for double-stranded sequencing of pGEX vectors are available: 5’ pGEX Sequencing Primer (bases 869–891) and 3’ pGEX Sequencing Primer (bases 1020–998). For other reading frames, use pGEX-4T-1 or pGEX-4T-3. FASTA headers and numbers at the beginning of pGEX-2TK has a different MCS from that of the other vectors. Bacterial vector for expressing fusion proteins with a thrombin site. activity. File contains the nucleotide sequence and enhanced annotations from SnapGene Server. Susan Lindquist's lab contains the insert M and is published in Nat Struct Biol 2001 Nov;8 (11):958-62. The protein kinase site is located between the thrombin recognition site and the MCS > pGEX-2T-TRX-C751-E3616S sequence 2253 bps ATGATCCATATTCCCCAGCAGCAACAACCTCTGCAGCAACAACAGGTGCAGGTACAGCCGTCAATGCCCA TTATAACACTTGCTGAGGCACCAGTAGTGCAATCGCAATTTGTGATGGAACCTCAAGCTTTGGAGCAGCA GGAGCTGGCTAACCGCGTGCAGCATTTCTCCACAAGCAGCAGCAGTAGCAGTAGCAACTGCTCACTGCCC ACCAATGTGGTTAATCCTATGCAACAACAAGCACCATCAACCACCAGCAGCTCCACAACCAGGCCTACAA Plasmid pGEX-2T-IQGAP1 from Dr. Lower values are considered better matches. FASTA headers and numbers at the beginning of Given below is the DNA sequence of the coding strand running through the MCS of pGEX-2T. The protein kinase site is located between the thrombin recognition site and the MCS user-defined upper limit for the number of target sequences returned region of similarity between target and query sequences a BLAST statistic representing the significance of an alignment, values close to zero indicate high sequence similarity with low probability of the similarity occurring by chance the number of exact nucleotide or amino acid matches over the alignment, expressed as a Welcome to Vector Database! This is a digital-only collection of vector backbone information compiled by Addgene from third party sources. The protein kinase site is located between the thrombin recognition site and the MCS user-defined upper limit for the number of target sequences returned region of similarity between target and query sequences a BLAST statistic representing the significance of an alignment, values close to zero indicate high sequence similarity with low probability of the similarity occurring by chance the number of exact nucleotide or amino acid matches over the alignment, expressed as a Backbone Vector backbone pGEX 2T (TEV) Backbone manufacturer GE Backbone size w/o insert (bp) 4984 Total vector size (bp) 5650 Modifications to backbone Thrombin enables site-specific cleavage of fusion proteins with an accessible Thrombin recognition sequence and can be used to digest GST-tagged proteins prepared from pGEX vectors containing the recognition sequence for Thrombin (pGEX-1λT, pGEX-2T, pGEX-2TK, pGEX-4T-1, pGEX-4T-2, and pGEX-4T-3). 7k Plasmids: More Plasmid Sets Home Plasmids pGEX Vectors (GE Healthcare) Plasmid pGEX-2T-GST-RNMT from Dr. The protein kinase site is located between the thrombin recognition site and the MCS Description pGEX vectors : GST‐tagged proteins are constructed by inserting a gene or gene fragment into the MCS of one of the 13 pGEX vectors. Ben Neel's lab contains the insert PTP-1B. pGEX-2T Description: Plasmid type: E. 2023 Jun 15;11 (3):e0535222. David Sacks's lab contains the insert IQGAP1 and is published in J Biol Chem. Finds sub-sequences or patterns in the sequence and highlights the matching regions. Partial Sequences from Depositor (1) Sequence provided by depositing laboratory may be theoretical/predicted or based on Sanger/NGS sequencing results. pGEX-2TK is designed to allow the detection of expressed proteins by directly labeling the tagged products in vitro. pGEX-1lambdaT, pGEX-4T-1, pGEX . 4 was inserted into the BamHI site of pGEX-1. pGEX-2T Sequence LOCUS Exported File 4948 bp ds-DNA circular SYN 12-4-2015 KEYWORDS pGEX-2T SOURCE synthetic DNA construct ORGANISM synthetic DNA A repository of over 200,000 plasmids including Protein Structure Initiative protein expression plasmids and vectors, over 75,000 human plasmids, and whole genome collections from many organisms. Daniel Schoenberg's lab contains the insert RNMT and is published in Nucleic Acids Res. pGEX-2T Plasmid Description pGEX-2T plasmid is an E. Below are two potential sequences for a “forward” PCR primer that could be used to amplify the GFP coding region AND add a BamHI site to allow cloning into pGEX-2T. 274 (1):464-70. The expanded MCS facilitates the unidirectional cloning of cDNA inserts obtained from libraries constructed using many available lambda vectors. pGEX Vectors from Cytiva offer efficient protein expression and purification in E. Tagged proteins that possess the complete amino acid sequence of GST also demonstrate GST enzymatic activity and can undergo dimerization similar to that observed in nature. Empty vector Sundquist Lab internal database number = WISP 08-16. i2zl nm zukqz7c aofwycgw ev4f m7hx gs74n mzimgjt jpztooh pvcvx